Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTCTCCAGTGGGACAGCGCATCG[A/G]TGAGTCCCTGGAGCCCCCCACAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604702 MIM: 604700 | ||||||||||||||||||||
Literature Links: |
HMGXB4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HMGXB4 - HMG-box containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOM1 - target of myb1 membrane trafficking protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135729.1 | Intron | NP_001129201.1 | ||||
NM_001135730.1 | Intron | NP_001129202.1 | ||||
NM_001135732.1 | Intron | NP_001129204.1 | ||||
NM_005488.2 | Intron | NP_005479.1 | ||||
XM_011529818.2 | Intron | XP_011528120.1 | ||||
XM_011529820.2 | Intron | XP_011528122.1 | ||||
XM_017028529.1 | Intron | XP_016884018.1 | ||||
XM_017028530.1 | Intron | XP_016884019.1 |