Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGACCCCGGCGTGTCGGTGCGGGC[A/G]GAACCTTTTCTTCAGAAGACCTGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608797 MIM: 601304 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C22orf46 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C22orf46 - chromosome 22 open reading frame 46 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MEI1 - meiotic double-stranded break formation protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152513.3 | Intron | NP_689726.3 | ||||
XM_011529935.1 | Intron | XP_011528237.1 | ||||
XM_011529936.1 | Intron | XP_011528238.1 | ||||
XM_011529937.1 | Intron | XP_011528239.1 | ||||
XM_011529938.1 | Intron | XP_011528240.1 | ||||
XM_011529939.1 | Intron | XP_011528241.1 | ||||
XM_011529940.1 | Intron | XP_011528242.1 | ||||
XM_011529941.1 | Intron | XP_011528243.1 | ||||
XM_011529942.2 | Intron | XP_011528244.1 | ||||
XM_011529943.1 | Intron | XP_011528245.1 | ||||
XM_011529944.1 | Intron | XP_011528246.1 | ||||
XM_011529945.2 | Intron | XP_011528247.1 | ||||
XM_011529946.1 | Intron | XP_011528248.1 | ||||
XM_011529947.1 | Intron | XP_011528249.1 | ||||
XM_011529948.2 | Intron | XP_011528250.1 | ||||
XM_011529949.1 | Intron | XP_011528251.1 | ||||
XM_011529950.1 | Intron | XP_011528252.1 | ||||
XM_011529952.1 | Intron | XP_011528254.1 | ||||
XM_011529954.1 | Intron | XP_011528256.1 | ||||
XM_011529955.1 | Intron | XP_011528257.1 | ||||
XM_011529956.2 | Intron | XP_011528258.1 | ||||
XM_017028633.1 | Intron | XP_016884122.1 | ||||
XM_017028635.1 | Intron | XP_016884124.1 |
SNU13 - SNU13 homolog, small nuclear ribonucleoprotein (U4/U6.U5) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |