Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCGTAGTAATCCGTGAAGAGGCC[A/G]TCAGGGTTGAGCAGGTAGATGGCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611230 MIM: 604272 MIM: 131222 | ||||||||||||||||||||
Literature Links: |
NCAPH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NCAPH2 - non-SMC condensin II complex subunit H2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001185011.1 | 849 | UTR 3 | NP_001171940.1 | |||
NM_014551.4 | 849 | Intron | NP_055366.3 | |||
NM_152299.3 | 849 | UTR 3 | NP_689512.2 | |||
XM_005261912.4 | 849 | Intron | XP_005261969.1 | |||
XM_011530685.2 | 849 | Intron | XP_011528987.1 | |||
XM_017028793.1 | 849 | Intron | XP_016884282.1 |
ODF3B - outer dense fiber of sperm tails 3B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCO2 - SCO2 cytochrome c oxidase assembly protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001169109.1 | 849 | Silent Mutation | GAC,GAT | D,D 234 | NP_001162580.1 | |
NM_001169110.1 | 849 | Silent Mutation | GAC,GAT | D,D 234 | NP_001162581.1 | |
NM_001169111.1 | 849 | Silent Mutation | GAC,GAT | D,D 234 | NP_001162582.1 | |
NM_005138.2 | 849 | Silent Mutation | GAC,GAT | D,D 234 | NP_005129.2 |
TYMP - thymidine phosphorylase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |