Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGACAATGCTACCCCAGTGGCTGC[C/T]GAAGAAGGCCTGAGTGGCCTGTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 301300 MIM: 300773 MIM: 311790 | ||||||||||||||||||||
Literature Links: |
ALAS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALAS2 - 5'-aminolevulinate synthase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APEX2 - apurinic/apyrimidinic endodeoxyribonuclease 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271748.1 | 385 | Intron | NP_001258677.1 | |||
NM_014481.3 | 385 | Silent Mutation | GCC,GCT | A,A 95 | NP_055296.2 |
PFKFB1 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |