Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTCCACTAGTCGCCATCTCCACA[C/T]ATTCATCTATCACAAGGTTCATAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616275 MIM: 610995 MIM: 603542 | ||||||||||||||||||||
Literature Links: |
FAM136A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM136A - family with sequence similarity 136 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCYOX1 - prenylcysteine oxidase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNRPG - small nuclear ribonucleoprotein polypeptide G | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317165.1 | 886 | Intron | NP_001304094.1 | |||
NM_001317166.1 | 886 | Intron | NP_001304095.1 | |||
NM_001317167.1 | 886 | Intron | NP_001304096.1 | |||
NM_001317168.1 | 886 | Missense Mutation | TAT,TGT | Y,C 33 | NP_001304097.1 | |
NM_001317169.1 | 886 | Intron | NP_001304098.1 | |||
NM_001317171.1 | 886 | Intron | NP_001304100.1 | |||
NM_003096.3 | 886 | Intron | NP_003087.1 | |||
XM_017004774.1 | 886 | Missense Mutation | TAT,TGT | Y,C 45 | XP_016860263.1 |