Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAAGGGGATTCTAAGCCATTTCC[C/T]ATCAGCCGTTTACTAAGTAGCCTGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 605353 | |||||||||||||||||||||||
Literature Links: |
GHRL PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GHRL - ghrelin/obestatin prepropeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GHRLOS - ghrelin opposite strand/antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC00852 - long intergenic non-protein coding RNA 852 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TATDN2 - TatD DNase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |