Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATGCACACCCACTGCCCATCAAC[G/T]GACTCCTTCCACAGGGTCACCTGCG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 605353 MIM: 600152 | |||||||||||||||||||||||
Literature Links: |
GHRL PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GHRL - ghrelin/obestatin prepropeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GHRLOS - ghrelin opposite strand/antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEC13 - SEC13 homolog, nuclear pore and COPII coat complex component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136026.2 | 1190 | Silent Mutation | TCA,TCC | S,S 338 | NP_001129498.1 | |
NM_001136232.2 | 1190 | Intron | NP_001129704.1 | |||
NM_001278946.1 | 1190 | Intron | NP_001265875.1 | |||
NM_030673.3 | 1190 | Intron | NP_109598.2 | |||
NM_183352.2 | 1190 | Intron | NP_899195.1 | |||
XM_005265379.2 | 1190 | Intron | XP_005265436.1 | |||
XM_017007019.1 | 1190 | Intron | XP_016862508.1 | |||
XM_017007020.1 | 1190 | Intron | XP_016862509.1 | |||
XM_017007021.1 | 1190 | Intron | XP_016862510.1 |