Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATTTTGGTCCCTTTTGTTCCCAG[A/G]GATTGTATCTTAAAGTCCGAGAGAC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 161565 MIM: 604028 | |||||||||||||||||||||||
Literature Links: |
LOC101928323 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LOC101928323 - uncharacterized LOC101928323 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NKTR - natural killer cell triggering receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005385.3 | Intron | NP_005376.2 | ||||
XM_005265173.1 | Intron | XP_005265230.1 | ||||
XM_006713171.1 | Intron | XP_006713234.1 | ||||
XM_006713173.2 | Intron | XP_006713236.1 | ||||
XM_011533747.2 | Intron | XP_011532049.1 | ||||
XM_011533750.2 | Intron | XP_011532052.1 | ||||
XM_017006474.1 | Intron | XP_016861963.1 | ||||
XM_017006475.1 | Intron | XP_016861964.1 | ||||
XM_017006476.1 | Intron | XP_016861965.1 | ||||
XM_017006477.1 | Intron | XP_016861966.1 | ||||
XM_017006478.1 | Intron | XP_016861967.1 | ||||
XM_017006479.1 | Intron | XP_016861968.1 | ||||
XM_017006480.1 | Intron | XP_016861969.1 |
SEC22C - SEC22 homolog C, vesicle trafficking protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |