Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTAGTTAGCCATTCACTTTGCCCC[C/G]AGCTCACCACGCGCAGCGCCATGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 104620 MIM: 601832 | ||||||||||||||||||||
Literature Links: |
ABHD14A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABHD14A - abhydrolase domain containing 14A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ABHD14A-ACY1 - ABHD14A-ACY1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316331.1 | Intron | NP_001303260.1 |
ABHD14B - abhydrolase domain containing 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ACY1 - aminoacylase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000666.2 | Intron | NP_000657.1 | ||||
NM_001198895.1 | Intron | NP_001185824.1 | ||||
NM_001198896.1 | Intron | NP_001185825.1 | ||||
NM_001198897.1 | Intron | NP_001185826.1 | ||||
NM_001198898.1 | Intron | NP_001185827.1 |
RPL29 - ribosomal protein L29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |