Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTAGGTTGCTAGGAAAGGACCAC[A/G]AGGGGGCCCGCTGCAGAGAACGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613210 MIM: 611846 MIM: 612122 | ||||||||||||||||||||
Literature Links: |
DPH7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPH7 - diphthamide biosynthesis 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138778.3 | 1026 | Missense Mutation | TCG,TTG | S,L 353 | NP_620133.1 | |
XM_005266123.2 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_005266180.1 | |
XM_005266126.3 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_005266183.1 | |
XM_005266128.2 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_005266185.1 | |
XM_005266129.2 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_005266186.1 | |
XM_005266130.2 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_005266187.1 | |
XM_011519188.1 | 1026 | Missense Mutation | TCG,TTG | S,L 331 | XP_011517490.1 | |
XM_011519189.1 | 1026 | Missense Mutation | TCG,TTG | S,L 313 | XP_011517491.1 | |
XM_011519190.2 | 1026 | Intron | XP_011517492.1 | |||
XM_011519191.2 | 1026 | UTR 3 | XP_011517493.1 | |||
XM_011519192.2 | 1026 | Intron | XP_011517494.1 | |||
XM_011519193.2 | 1026 | UTR 3 | XP_011517495.1 | |||
XM_011519194.1 | 1026 | Intron | XP_011517496.1 | |||
XM_011519199.2 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_011517501.1 | |
XM_011519200.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_011517502.1 | |
XM_017015289.1 | 1026 | UTR 3 | XP_016870778.1 | |||
XM_017015290.1 | 1026 | UTR 3 | XP_016870779.1 | |||
XM_017015291.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870780.1 | |
XM_017015292.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870781.1 | |
XM_017015293.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870782.1 | |
XM_017015294.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870783.1 | |
XM_017015295.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870784.1 | |
XM_017015296.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870785.1 | |
XM_017015297.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870786.1 | |
XM_017015298.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870787.1 | |
XM_017015299.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870788.1 | |
XM_017015300.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870789.1 | |
XM_017015301.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870790.1 | |
XM_017015302.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870791.1 | |
XM_017015303.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870792.1 | |
XM_017015304.1 | 1026 | Missense Mutation | TCG,TTG | S,L 177 | XP_016870793.1 | |
XM_017015305.1 | 1026 | Missense Mutation | TCG,TTG | S,L 155 | XP_016870794.1 | |
XM_017015306.1 | 1026 | Missense Mutation | TCG,TTG | S,L 155 | XP_016870795.1 | |
XM_017015307.1 | 1026 | Missense Mutation | TCG,TTG | S,L 155 | XP_016870796.1 | |
XM_017015308.1 | 1026 | Missense Mutation | TCG,TTG | S,L 155 | XP_016870797.1 | |
XM_017015309.1 | 1026 | Missense Mutation | TCG,TTG | S,L 155 | XP_016870798.1 |
MRPL41 - mitochondrial ribosomal protein L41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNPLA7 - patatin like phospholipase domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |