Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCAAGATTGAAGAGCTTGTGGCC[A/C]AGAAGATGGAGTTGCAGGTGGTTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607001 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARRDC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARRDC1 - arrestin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ARRDC1-AS1 - ARRDC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EHMT1 - euchromatic histone lysine methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145527.1 | Intron | NP_001138999.1 | ||||
NM_024757.4 | Intron | NP_079033.4 | ||||
XM_005266105.4 | Intron | XP_005266162.1 | ||||
XM_005266110.1 | Intron | XP_005266167.1 | ||||
XM_006717288.2 | Intron | XP_006717351.1 | ||||
XM_011519021.2 | Intron | XP_011517323.1 | ||||
XM_011519022.2 | Intron | XP_011517324.1 | ||||
XM_011519023.2 | Intron | XP_011517325.1 | ||||
XM_011519024.2 | Intron | XP_011517326.1 | ||||
XM_011519025.1 | Intron | XP_011517327.1 | ||||
XM_011519026.2 | Intron | XP_011517328.1 | ||||
XM_011519027.2 | Intron | XP_011517329.1 | ||||
XM_011519028.2 | Intron | XP_011517330.1 | ||||
XM_011519029.2 | Intron | XP_011517331.1 | ||||
XM_011519030.2 | Intron | XP_011517332.1 | ||||
XM_011519031.1 | Intron | XP_011517333.1 | ||||
XM_011519033.2 | Intron | XP_011517335.1 | ||||
XM_017015134.1 | Intron | XP_016870623.1 | ||||
XM_017015135.1 | Intron | XP_016870624.1 | ||||
XM_017015136.1 | Intron | XP_016870625.1 | ||||
XM_017015137.1 | Intron | XP_016870626.1 | ||||
XM_017015138.1 | Intron | XP_016870627.1 |