Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAATGCCACTATCCTTCCCATCTCT[C/G]TTACCCTCAGTACCACACAATACTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604562 | ||||||||||||||||||||
Literature Links: |
ACIN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACIN1 - apoptotic chromatin condensation inducer 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C14orf119 - chromosome 14 open reading frame 119 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017924.3 | 195 | Silent Mutation | CTC,CTG | L,L 16 | NP_060394.1 | |
XM_017021390.1 | 195 | Silent Mutation | CTC,CTG | L,L 16 | XP_016876879.1 |
LOC100128908 - leishmanolysin homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |