Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCACCCGCATGGCGGGTGCCGGC[C/T]GCAGCGAGAGGCATTGCCTCACGCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611709 MIM: 611710 MIM: 611708 MIM: 611711 MIM: 611896 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR127 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR127 - microRNA 127 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR136 - microRNA 136 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR337 - microRNA 337 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR431 - microRNA 431 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR432 - microRNA 432 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR433 - microRNA 433 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR665 - microRNA 665 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTL1 - retrotransposon-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134888.2 | 3382 | Missense Mutation | CAG,CGG | Q,R 1108 | NP_001128360.1 |