Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCAGTGTTGACTACTGGTGTCGT[A/G]TGAGTCATACAATGAATACATGTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNHG24 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SNHG24 - small nucleolar RNA host gene 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-20 - small nucleolar RNA, C/D box 114-20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-21 - small nucleolar RNA, C/D box 114-21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-22 - small nucleolar RNA, C/D box 114-22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-23 - small nucleolar RNA, C/D box 114-23 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-24 - small nucleolar RNA, C/D box 114-24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-25 - small nucleolar RNA, C/D box 114-25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-26 - small nucleolar RNA, C/D box 114-26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-27 - small nucleolar RNA, C/D box 114-27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-28 - small nucleolar RNA, C/D box 114-28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-29 - small nucleolar RNA, C/D box 114-29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-30 - small nucleolar RNA, C/D box 114-30 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD114-31 - small nucleolar RNA, C/D box 114-31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |