Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCCGTTCTCCAACCCTTTGGCCC[A/C]CGATGGCCACGATGTGGATGATCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600549 MIM: 602137 | ||||||||||||||||||||
Literature Links: |
IK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IK - IK cytokine, down-regulator of HLA II | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006083.3 | 154 | Missense Mutation | CAC,CCC | H,P 15 | NP_006074.2 |
MIR3655 - microRNA 3655 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFA2 - NADH:ubiquinone oxidoreductase subunit A2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001185012.1 | 154 | Intron | NP_001171941.1 | |||
NM_002488.4 | 154 | Intron | NP_002479.1 |
TMCO6 - transmembrane and coiled-coil domains 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |