Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGTTCCCAACCTCACGTGACACAG[C/T]GGTCACGTGACATGGCCCCGGGGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601444 MIM: 155740 MIM: 600536 MIM: 601617 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BLOC1S1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BLOC1S1 - biogenesis of lysosomal organelles complex 1 subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001487.3 | 7 | UTR 5 | NP_001478.2 |
BLOC1S1-RDH5 - BLOC1S1-RDH5 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CD63 - CD63 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITGA7 - integrin subunit alpha 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144996.1 | 7 | Intron | NP_001138468.1 | |||
NM_001144997.1 | 7 | Intron | NP_001138469.1 | |||
NM_002206.2 | 7 | Intron | NP_002197.2 | |||
XM_005268839.1 | 7 | Intron | XP_005268896.1 | |||
XM_005268840.1 | 7 | Intron | XP_005268897.1 | |||
XM_005268841.1 | 7 | Intron | XP_005268898.1 | |||
XM_005268842.1 | 7 | Intron | XP_005268899.1 | |||
XM_005268844.1 | 7 | Intron | XP_005268901.1 | |||
XM_005268846.1 | 7 | Intron | XP_005268903.1 | |||
XM_005268848.1 | 7 | Intron | XP_005268905.1 | |||
XM_005268849.1 | 7 | Intron | XP_005268906.1 | |||
XM_005268850.1 | 7 | Intron | XP_005268907.1 | |||
XM_017019265.1 | 7 | Intron | XP_016874754.1 |
RDH5 - retinol dehydrogenase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |