Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCTGGATGGAGGTGGGTAACACTC[A/T]CCATCCTGGGGTTTGCCTTCCTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615521 | ||||||||||||||||||||
Literature Links: |
NDUFA4L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NDUFA4L2 - NDUFA4, mitochondrial complex associated like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
R3HDM2 - R3H domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAC3 - SH3 and cysteine rich domain 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286256.1 | Intron | NP_001273185.1 | ||||
NM_001286257.1 | Intron | NP_001273186.1 | ||||
NM_145064.2 | Intron | NP_659501.1 | ||||
XM_011538126.2 | Intron | XP_011536428.1 |