Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTATAACTTTATTAATAGGAAGCA[A/G]AATCTTTAATTGCAAAAAAGATTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605139 MIM: 607743 | ||||||||||||||||||||
Literature Links: |
CCT2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCT2 - chaperonin containing TCP1 subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198842.1 | 434 | Missense Mutation | AAA,GAA | K,E 67 | NP_001185771.1 | |
NM_006431.2 | 434 | Missense Mutation | AAA,GAA | K,E 114 | NP_006422.1 |
FRS2 - fibroblast growth factor receptor substrate 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3913-1 - microRNA 3913-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3913-2 - microRNA 3913-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |