Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAGGTGTATGTAAATACATCTCC[A/G]TTTTACGTTCTTTAATCGCTTAATC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607663 MIM: 610693 MIM: 616283 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DDX25 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DDX25 - DEAD-box helicase 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HYLS1 - HYLS1, centriolar and ciliogenesis associated | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134793.1 | 1772 | Intron | NP_001128265.1 | |||
NM_145014.2 | 1772 | Intron | NP_659451.1 | |||
XM_005271430.2 | 1772 | Intron | XP_005271487.1 | |||
XM_006718777.3 | 1772 | Intron | XP_006718840.1 | |||
XM_011542659.2 | 1772 | Intron | XP_011540961.1 | |||
XM_017017320.1 | 1772 | Intron | XP_016872809.1 | |||
XM_017017321.1 | 1772 | Intron | XP_016872810.1 |
PUS3 - pseudouridylate synthase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271985.1 | 1772 | UTR 3 | NP_001258914.1 | |||
NM_031307.3 | 1772 | UTR 3 | NP_112597.3 | |||
XM_005271687.3 | 1772 | UTR 3 | XP_005271744.1 | |||
XM_005271688.3 | 1772 | Intron | XP_005271745.1 |