Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGCTTTCTGAATGCAATGCACCC[A/G]GGCAAGGATTCTGAGAGGGTGAGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 300008 MIM: 300893 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CLCN5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CLCN5 - chloride voltage-gated channel 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000084.4 | Intron | NP_000075.1 | ||||
NM_001127898.3 | Intron | NP_001121370.1 | ||||
NM_001127899.3 | Intron | NP_001121371.1 | ||||
NM_001272102.1 | Intron | NP_001259031.1 | ||||
NM_001282163.1 | Intron | NP_001269092.1 | ||||
XM_017029257.1 | Intron | XP_016884746.1 | ||||
XM_017029258.1 | Intron | XP_016884747.1 |
MIR188 - microRNA 188 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR362 - microRNA 362 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR500A - microRNA 500a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR500B - microRNA 500b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR501 - microRNA 501 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR502 - microRNA 502 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR532 - microRNA 532 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR660 - microRNA 660 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |