Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGACTTCACGTGCCCGTTTCCTTC[G/A]CAGTCTCTCAGCATTTGTGATCATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611206 MIM: 609204 | ||||||||||||||||||||
Literature Links: |
CFAP70 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFAP70 - cilia and flagella associated protein 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DNAJC9 - DnaJ heat shock protein family (Hsp40) member C9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DNAJC9-AS1 - DNAJC9 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM149B1 - family with sequence similarity 149 member B1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS16 - mitochondrial ribosomal protein S16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016065.3 | Intron | NP_057149.1 | ||||
XM_017016305.1 | Intron | XP_016871794.1 |