Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAACCGTAGACAGTTTAAAATCC[A/T]ATAAACAAAGCAAACAGTTTAGATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612333 MIM: 601787 MIM: 615204 | ||||||||||||||||||||
Literature Links: |
MIR1307 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR1307 - microRNA 1307 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDCD11 - programmed cell death 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF5 - TATA-box binding protein associated factor 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006951.4 | Intron | NP_008882.2 | ||||
NM_139052.2 | Intron | NP_620640.1 |
USMG5 - up-regulated during skeletal muscle growth 5 homolog (mouse) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206426.1 | Intron | NP_001193355.1 | ||||
NM_001206427.1 | Intron | NP_001193356.1 | ||||
NM_032747.3 | Intron | NP_116136.1 |