Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTAGCCTGAGTCTCCATTGCTTGGA[A/G]CAGCCACAGTGGACACTGGACGGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603801 MIM: 606116 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACBD7 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACBD7 - acyl-CoA binding domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C10orf111 - chromosome 10 open reading frame 111 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153244.1 | 463 | Silent Mutation | TGC,TGT | C,C 63 | NP_694976.1 |
NMT2 - N-myristoyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPP38 - ribonuclease P/MRP subunit p38 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001097590.2 | 463 | Intron | NP_001091059.1 | |||
NM_001265601.1 | 463 | Intron | NP_001252530.1 | |||
NM_006414.4 | 463 | Intron | NP_006405.2 | |||
NM_183005.4 | 463 | Intron | NP_892117.1 | |||
XM_006717363.1 | 463 | Intron | XP_006717426.1 | |||
XM_006717364.3 | 463 | Intron | XP_006717427.1 | |||
XM_011519293.1 | 463 | Intron | XP_011517595.1 | |||
XM_017015479.1 | 463 | Intron | XP_016870968.1 | |||
XM_017015480.1 | 463 | Intron | XP_016870969.1 | |||
XM_017015481.1 | 463 | Intron | XP_016870970.1 |