Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTCACTAATTGACCGTGTCAGCT[A/G]GTGCCGCTTGTAGTCAGTGTCTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607803 MIM: 600417 | ||||||||||||||||||||
Literature Links: |
CNNM2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNNM2 - cyclin and CBS domain divalent metal cation transport mediator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NT5C2 - 5'-nucleotidase, cytosolic II | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134373.2 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 523 | NP_001127845.1 | |
NM_012229.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 523 | NP_036361.1 | |
XM_005269632.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 531 | XP_005269689.1 | |
XM_005269633.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 531 | XP_005269690.1 | |
XM_005269634.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 531 | XP_005269691.1 | |
XM_005269635.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 531 | XP_005269692.1 | |
XM_005269636.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 523 | XP_005269693.1 | |
XM_005269637.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 502 | XP_005269694.1 | |
XM_005269638.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 499 | XP_005269695.1 | |
XM_005269639.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 494 | XP_005269696.1 | |
XM_005269640.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269697.1 | |
XM_005269641.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269698.1 | |
XM_005269642.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269699.1 | |
XM_005269643.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269700.1 | |
XM_005269644.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269701.1 | |
XM_005269645.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269702.1 | |
XM_005269646.4 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_005269703.1 | |
XM_006717721.3 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_006717784.1 | |
XM_006717723.3 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_006717786.1 | |
XM_011539537.2 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 474 | XP_011537839.1 | |
XM_017015947.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 500 | XP_016871436.1 | |
XM_017015948.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 492 | XP_016871437.1 | |
XM_017015949.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871438.1 | |
XM_017015950.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871439.1 | |
XM_017015951.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871440.1 | |
XM_017015952.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871441.1 | |
XM_017015953.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871442.1 | |
XM_017015954.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871443.1 | |
XM_017015955.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871444.1 | |
XM_017015956.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871445.1 | |
XM_017015957.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871446.1 | |
XM_017015958.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871447.1 | |
XM_017015959.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871448.1 | |
XM_017015960.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871449.1 | |
XM_017015961.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871450.1 | |
XM_017015962.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871451.1 | |
XM_017015963.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871452.1 | |
XM_017015964.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871453.1 | |
XM_017015965.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871454.1 | |
XM_017015966.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871455.1 | |
XM_017015967.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871456.1 | |
XM_017015968.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871457.1 | |
XM_017015969.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871458.1 | |
XM_017015970.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871459.1 | |
XM_017015971.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 332 | XP_016871460.1 | |
XM_017015972.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 285 | XP_016871461.1 | |
XM_017015973.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 285 | XP_016871462.1 | |
XM_017015974.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 285 | XP_016871463.1 | |
XM_017015975.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 285 | XP_016871464.1 | |
XM_017015976.1 | 1695 | Nonsense Mutation | CAG,TAG | Q,* 285 | XP_016871465.1 |