Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGAAGAGGACGAGGTCATTGACGA[A/G]GTGAGAAGGACACGCTCCCCTAGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611883 MIM: 606938 | ||||||||||||||||||||
Literature Links: |
BCCIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCCIP - BRCA2 and CDKN1A interacting protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016567.3 | 188 | Silent Mutation | GAA,GAG | E,E 55 | NP_057651.1 | |
NM_078468.2 | 188 | Silent Mutation | GAA,GAG | E,E 55 | NP_510868.1 | |
NM_078469.2 | 188 | Silent Mutation | GAA,GAG | E,E 55 | NP_510869.1 |
MIR4484 - microRNA 4484 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UROS - uroporphyrinogen III synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000375.2 | 188 | Intron | NP_000366.1 | |||
NM_001324036.1 | 188 | Intron | NP_001310965.1 | |||
NM_001324037.1 | 188 | Intron | NP_001310966.1 | |||
NM_001324038.1 | 188 | Intron | NP_001310967.1 | |||
NM_001324039.1 | 188 | Intron | NP_001310968.1 | |||
XM_005270140.4 | 188 | Intron | XP_005270197.1 | |||
XM_011540127.1 | 188 | Intron | XP_011538429.1 | |||
XM_017016610.1 | 188 | Intron | XP_016872099.1 | |||
XM_017016611.1 | 188 | Intron | XP_016872100.1 | |||
XM_017016612.1 | 188 | Intron | XP_016872101.1 |