Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCTGGAGGATGGCGGACGCCGGC[A/G]TTCGCCGCGTGGTTCCCAGCGACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602394 | ||||||||||||||||||||
Literature Links: |
NOLC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NOLC1 - nucleolar and coiled-body phosphoprotein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284388.1 | 251 | Missense Mutation | ATT,GTT | I,V 6 | NP_001271317.1 | |
NM_001284389.1 | 251 | Missense Mutation | ATT,GTT | I,V 6 | NP_001271318.1 | |
NM_004741.4 | 251 | Missense Mutation | ATT,GTT | I,V 6 | NP_004732.2 | |
XM_005270273.1 | 251 | Missense Mutation | ATT,GTT | I,V 6 | XP_005270330.1 |
PPRC1 - peroxisome proliferator-activated receptor gamma, coactivator-related 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |