Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTACATGACAGAAAAACTGTGGCG[C/T]CCCATGCACCTGGGCGCTGTGCCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608842 MIM: 616932 MIM: 607185 | ||||||||||||||||||||
Literature Links: |
CHCHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHCHD1 - coiled-coil-helix-coiled-coil-helix domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FUT11 - fucosyltransferase 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284194.1 | 1044 | Silent Mutation | CGC,CGT | R,R 295 | NP_001271123.1 | |
NM_173540.2 | 1044 | Silent Mutation | CGC,CGT | R,R 295 | NP_775811.2 | |
XM_006717656.3 | 1044 | Silent Mutation | CGC,CGT | R,R 295 | XP_006717719.1 |
SEC24C - SEC24 homolog C, COPII coat complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |