Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTTGAAGCTTATTCCCTATCAGAT[A/G]ATGATTATGACGGAATTAAGAAATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611883 MIM: 607960 MIM: 606938 | ||||||||||||||||||||
Literature Links: |
BCCIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCCIP - BRCA2 and CDKN1A interacting protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016567.3 | 228 | Missense Mutation | AAT,GAT | N,D 69 | NP_057651.1 | |
NM_078468.2 | 228 | Missense Mutation | AAT,GAT | N,D 69 | NP_510868.1 | |
NM_078469.2 | 228 | Missense Mutation | AAT,GAT | N,D 69 | NP_510869.1 |
DHX32 - DEAH-box helicase 32 (putative) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4484 - microRNA 4484 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UROS - uroporphyrinogen III synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |