Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACCTGAGGGTCCGTGTGTAGTT[C/T]AGAAAGGGTGTGATACCCAGGAACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602123 MIM: 603268 | ||||||||||||||||||||
Literature Links: |
CAMK2G PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CAMK2G - calcium/calmodulin dependent protein kinase II gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDST2 - N-deacetylase and N-sulfotransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003635.3 | 1412 | Silent Mutation | CTA,CTG | L,L 801 | NP_003626.1 | |
XM_005270255.3 | 1412 | Intron | XP_005270312.1 | |||
XM_005270256.3 | 1412 | Silent Mutation | CTA,CTG | L,L 427 | XP_005270313.1 | |
XM_011540310.2 | 1412 | Silent Mutation | CTA,CTG | L,L 801 | XP_011538612.1 | |
XM_017016857.1 | 1412 | Silent Mutation | CTA,CTG | L,L 324 | XP_016872346.1 |
ZSWIM8 - zinc finger SWIM-type containing 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSWIM8-AS1 - ZSWIM8 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |