Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCATAGAGATGCTTGGTGGTGAGA[C/T]GCAGGCAGTACACAGGGCTGCTGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616467 MIM: 608071 | ||||||||||||||||||||
Literature Links: |
DPCD PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPCD - deleted in primary ciliary dyskinesia homolog (mouse) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXW4 - F-box and WD repeat domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001323541.1 | Intron | NP_001310470.1 | ||||
NM_022039.3 | Intron | NP_071322.1 | ||||
XM_005270053.2 | Intron | XP_005270110.2 | ||||
XM_017016570.1 | Intron | XP_016872059.1 |
MIR3158-1 - microRNA 3158-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3158-2 - microRNA 3158-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |