Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGTCTTCACAGCTCAAAGGCCAG[A/G]CTGGTGTTACCACTTCCTTCAGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606075 MIM: 610454 MIM: 611848 | ||||||||||||||||||||
Literature Links: |
C10orf2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C10orf2 - chromosome 10 open reading frame 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001163812.1 | 454 | Missense Mutation | ACT,GCT | T,A 94 | NP_001157284.1 | |
NM_001163813.1 | 454 | Intron | NP_001157285.1 | |||
NM_001163814.1 | 454 | Intron | NP_001157286.1 | |||
NM_021830.4 | 454 | Missense Mutation | ACT,GCT | T,A 94 | NP_068602.2 | |
XM_011539975.2 | 454 | Intron | XP_011538277.1 | |||
XM_017016437.1 | 454 | UTR 5 | XP_016871926.1 |
LZTS2 - leucine zipper tumor suppressor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL43 - mitochondrial ribosomal protein L43 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308396.1 | 454 | Intron | NP_001295325.1 | |||
NM_032112.2 | 454 | Intron | NP_115488.2 | |||
NM_176792.2 | 454 | Intron | NP_789762.1 | |||
NM_176793.1 | 454 | Intron | NP_789763.1 | |||
NM_176794.1 | 454 | Intron | NP_789764.1 | |||
XM_005270231.2 | 454 | Intron | XP_005270288.1 | |||
XM_006718035.3 | 454 | Intron | XP_006718098.1 | |||
XM_017016790.1 | 454 | Intron | XP_016872279.1 |
SEMA4G - semaphorin 4G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |