Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTTGTCTTCTCCCTTGGCACAGG[A/C]CAGGTCATCAAGGGCTGGGACCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604189 MIM: 186946 MIM: 600230 MIM: 601140 MIM: 601398 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DNAJC4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DNAJC4 - DnaJ heat shock protein family (Hsp40) member C4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FKBP2 - FK506 binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135208.1 | 445 | Silent Mutation | GGA,GGC | G,G 83 | NP_001128680.1 | |
NM_004470.3 | 445 | Silent Mutation | GGA,GGC | G,G 83 | NP_004461.2 | |
NM_057092.2 | 445 | Silent Mutation | GGA,GGC | G,G 83 | NP_476433.1 | |
XM_005273848.3 | 445 | Silent Mutation | GGA,GGC | G,G 83 | XP_005273905.1 |
LOC105369340 - uncharacterized LOC105369340 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLCB3 - phospholipase C beta 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R14B - protein phosphatase 1 regulatory inhibitor subunit 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VEGFB - vascular endothelial growth factor B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |