Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGACGATGGCCTGGAGTGTGTGC[A/C]CACTGGGCAGCACCAAGTCCGGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604189 MIM: 186946 MIM: 601140 MIM: 610470 MIM: 601398 | ||||||||||||||||||||
Literature Links: |
DNAJC4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNAJC4 - DnaJ heat shock protein family (Hsp40) member C4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FKBP2 - FK506 binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369340 - uncharacterized LOC105369340 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUDT22 - nudix hydrolase 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R14B - protein phosphatase 1 regulatory inhibitor subunit 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRPT1 - tRNA phosphotransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VEGFB - vascular endothelial growth factor B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243733.1 | 522 | Missense Mutation | CAC,CCC | H,P 91 | NP_001230662.1 | |
NM_003377.4 | 522 | Missense Mutation | CAC,CCC | H,P 91 | NP_003368.1 |