Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCGCTTACCTTCTCCGTTGCCGAC[C/G]TCCGGCGGCGGCGCCTGCAGCACCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608522 | ||||||||||||||||||||
Literature Links: |
AAMDC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AAMDC - adipogenesis associated Mth938 domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316957.1 | 326 | Intron | NP_001303886.1 | |||
NM_001316958.1 | 326 | Intron | NP_001303887.1 | |||
NM_001316960.1 | 326 | Intron | NP_001303889.1 | |||
NM_001316961.1 | 326 | Intron | NP_001303890.1 | |||
NM_001316962.1 | 326 | Intron | NP_001303891.1 | |||
NM_024684.3 | 326 | Intron | NP_078960.1 | |||
XM_011544968.2 | 326 | Intron | XP_011543270.1 | |||
XM_011544969.2 | 326 | Intron | XP_011543271.1 | |||
XM_017017620.1 | 326 | Intron | XP_016873109.1 |
RPS20P27 - ribosomal protein S20 pseudogene 27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RSF1 - remodeling and spacing factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016578.3 | 326 | Missense Mutation | GAC,GAG | D,E 57 | NP_057662.3 | |
XM_005274051.2 | 326 | Missense Mutation | GAC,GAG | D,E 57 | XP_005274108.1 | |
XM_017017923.1 | 326 | Intron | XP_016873412.1 |