Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCATCACTTAAGGAGGGCTGATG[A/G]TGGTTCCATCAGTATACAAACAGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611348 MIM: 608522 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AAMDC PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AAMDC - adipogenesis associated Mth938 domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316957.1 | 3738 | Intron | NP_001303886.1 | |||
NM_001316958.1 | 3738 | Intron | NP_001303887.1 | |||
NM_001316960.1 | 3738 | Intron | NP_001303889.1 | |||
NM_001316961.1 | 3738 | Intron | NP_001303890.1 | |||
NM_001316962.1 | 3738 | Intron | NP_001303891.1 | |||
NM_024684.3 | 3738 | Intron | NP_078960.1 | |||
XM_011544968.2 | 3738 | Intron | XP_011543270.1 | |||
XM_011544969.2 | 3738 | Intron | XP_011543271.1 | |||
XM_017017620.1 | 3738 | Intron | XP_016873109.1 |
INTS4 - integrator complex subunit 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033547.3 | 3738 | Intron | NP_291025.3 | |||
XM_011545352.2 | 3738 | Intron | XP_011543654.1 | |||
XM_011545353.2 | 3738 | Intron | XP_011543655.1 | |||
XM_017018560.1 | 3738 | UTR 3 | XP_016874049.1 |
RSF1 - remodeling and spacing factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |