Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCACGGAGAAGGGGCGCTGGATG[C/T]GTGAGGCATAGCTCCTGGGGAGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 176730 MIM: 191290 | ||||||||||||||||||||
Literature Links: |
INS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
INS - insulin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
INS-IGF2 - INS-IGF2 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4686 - microRNA 4686 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TH - tyrosine hydroxylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000360.3 | 3656 | Missense Mutation | CAC,CGC | H,R 450 | NP_000351.2 | |
NM_199292.2 | 3656 | Missense Mutation | CAC,CGC | H,R 481 | NP_954986.2 | |
NM_199293.2 | 3656 | Missense Mutation | CAC,CGC | H,R 477 | NP_954987.2 | |
XM_011520335.2 | 3656 | Missense Mutation | CAC,CGC | H,R 454 | XP_011518637.1 |