Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCTTGGGCCCCCGCTCTGCCAG[A/G]GCTGCGTGGCTGGGCTGCCCCTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 130593 MIM: 610641 | ||||||||||||||||||||
Literature Links: |
EEF1G PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EEF1G - eukaryotic translation elongation factor 1 gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6747 - microRNA 6747 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUT1 - terminal uridylyl transferase 1, U6 snRNA-specific | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022830.2 | 2354 | Silent Mutation | GCC,GCT | A,A 772 | NP_073741.2 |