Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAATGCGGCCACTCTGCAACTGG[C/T]CTTGGCACCAGCCCTGCTCGTCCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606908 MIM: 606513 | ||||||||||||||||||||
Literature Links: |
ARFGAP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARFGAP2 - ADP ribosylation factor GTPase activating protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242832.1 | 1425 | Intron | NP_001229761.1 | |||
NM_032389.4 | 1425 | Intron | NP_115765.2 | |||
XM_005253166.1 | 1425 | Intron | XP_005253223.1 | |||
XM_005253167.1 | 1425 | Intron | XP_005253224.1 | |||
XM_005253168.2 | 1425 | Intron | XP_005253225.1 | |||
XM_006718346.1 | 1425 | Intron | XP_006718409.1 | |||
XM_011520405.1 | 1425 | Intron | XP_011518707.1 | |||
XM_017018413.1 | 1425 | Intron | XP_016873902.1 | |||
XM_017018414.1 | 1425 | Intron | XP_016873903.1 | |||
XM_017018415.1 | 1425 | Intron | XP_016873904.1 |
MIR6745 - microRNA 6745 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PACSIN3 - protein kinase C and casein kinase substrate in neurons 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184974.1 | 1425 | Missense Mutation | GAC,GGC | D,G 404 | NP_001171903.1 | |
NM_001184975.1 | 1425 | Missense Mutation | GAC,GGC | D,G 404 | NP_001171904.1 | |
NM_016223.4 | 1425 | Missense Mutation | GAC,GGC | D,G 404 | NP_057307.2 |