Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCGCCAAGAATGCCACCAATGTC[A/G]AGCAGGCGTTCATGACCATGGCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611288 MIM: 611729 MIM: 612565 MIM: 611484 | ||||||||||||||||||||
Literature Links: |
CNIH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNIH2 - cornichon family AMPA receptor auxiliary protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLC2 - kinesin light chain 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB1B - RAB1B, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030981.2 | Intron | NP_112243.1 | ||||
XM_017018378.1 | Intron | XP_016873867.1 |
YIF1A - Yip1 interacting factor homolog A, membrane trafficking protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |