Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGCACCTCAGTCATGATACAGG[C/T]GCAGGAGGCAGCCGCGGAGGGTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605360 MIM: 602364 MIM: 608296 MIM: 136515 | ||||||||||||||||||||
Literature Links: |
CCDC85B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC85B - coiled-coil domain containing 85B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CTSW - cathepsin W | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001335.3 | 1200 | Intron | NP_001326.2 |
FIBP - FGF1 intracellular binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004214.4 | 1200 | Missense Mutation | CAC,CGC | H,R 353 | NP_004205.2 | |
NM_198897.1 | 1200 | Missense Mutation | CAC,CGC | H,R 360 | NP_942600.1 |
FOSL1 - FOS like 1, AP-1 transcription factor subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |