Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCCTCGGCGTCTACTACGTCGG[C/T]GTGGCCTCCTGCCTCCGCGAGCACG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614177 MIM: 609059 MIM: 180530 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CRACR2B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CRACR2B - calcium release activated channel regulator 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNPLA2 - patatin like phospholipase domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020376.3 | 221 | Silent Mutation | GGC,GGT | G,G 24 | NP_065109.1 | |
XM_006718265.3 | 221 | Silent Mutation | GGC,GGT | G,G 24 | XP_006718328.1 | |
XM_006718266.3 | 221 | Silent Mutation | GGC,GGT | G,G 24 | XP_006718329.1 | |
XM_017018028.1 | 221 | Silent Mutation | GGC,GGT | G,G 24 | XP_016873517.1 |
RPLP2 - ribosomal protein lateral stalk subunit P2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA52 - small nucleolar RNA, H/ACA box 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |