Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCTGGTCAGAGCCACACCTGTCT[C/T]GCAGACCACCACAGCTGCCACTGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604113 MIM: 164009 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
IL18BP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
IL18BP - interleukin 18 binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039659.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_001034748.1 | |
NM_001039660.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_001034749.1 | |
NM_001145055.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_001138527.1 | |
NM_001145057.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_001138529.1 | |
NM_005699.3 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_005690.2 | |
NM_173042.2 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_766630.2 | |
NM_173044.2 | 705 | Missense Mutation | TCG,TTG | S,L 34 | NP_766632.2 | |
XM_017017059.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | XP_016872548.1 | |
XM_017017060.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | XP_016872549.1 | |
XM_017017061.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | XP_016872550.1 | |
XM_017017062.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | XP_016872551.1 | |
XM_017017063.1 | 705 | Missense Mutation | TCG,TTG | S,L 34 | XP_016872552.1 |
NUMA1 - nuclear mitotic apparatus protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF121 - ring finger protein 121 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |