Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCGTCTCCACGTGCAAGAGGAAC[C/T]GGAGCGAGCTCCCCGACGAGGAGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614367 MIM: 602313 | ||||||||||||||||||||
Literature Links: |
AP5B1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AP5B1 - adaptor related protein complex 5 beta 1 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OVOL1 - ovo like transcriptional repressor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004561.3 | 395 | Missense Mutation | CGG,TGG | R,W 19 | NP_004552.2 | |
XM_005274018.3 | 395 | Intron | XP_005274075.1 | |||
XM_011545067.2 | 395 | Intron | XP_011543369.1 | |||
XM_011545068.2 | 395 | Intron | XP_011543370.1 | |||
XM_017017837.1 | 395 | Intron | XP_016873326.1 | |||
XM_017017838.1 | 395 | Intron | XP_016873327.1 |
OVOL1-AS1 - OVOL1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |