Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTGCAGGACACTCTCATACTTGC[A/G]CTTCGTCTCACGCAGCAACTCAATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601638 MIM: 607388 MIM: 605493 | ||||||||||||||||||||
Literature Links: |
ARFIP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARFIP2 - ADP ribosylation factor interacting protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242854.1 | 663 | Missense Mutation | CGC,TGC | R,C 171 | NP_001229783.1 | |
NM_001242855.1 | 663 | Missense Mutation | CGC,TGC | R,C 100 | NP_001229784.1 | |
NM_001242856.1 | 663 | Missense Mutation | CGC,TGC | R,C 53 | NP_001229785.1 | |
NM_012402.3 | 663 | Missense Mutation | CGC,TGC | R,C 138 | NP_036534.1 | |
XM_005252840.4 | 663 | Missense Mutation | CGC,TGC | R,C 138 | XP_005252897.1 |
TIMM10B - translocase of inner mitochondrial membrane 10 homolog B (yeast) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM3 - tripartite motif containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |