Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGCTGCTGGCCCCTGCGCAGCCT[A/C]CGCGCAGAGCGCTTATCCTGCAGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616225 MIM: 610939 MIM: 610941 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATG2A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATG2A - autophagy related 2A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015104.2 | 5465 | Silent Mutation | CGG,CGT | R,R 1836 | NP_055919.2 | |
XM_005273849.3 | 5465 | Silent Mutation | CGG,CGT | R,R 1830 | XP_005273906.1 | |
XM_005273850.3 | 5465 | Silent Mutation | CGG,CGT | R,R 1828 | XP_005273907.1 | |
XM_011544863.2 | 5465 | Silent Mutation | CGG,CGT | R,R 1838 | XP_011543165.1 | |
XM_011544864.2 | 5465 | Silent Mutation | CGG,CGT | R,R 1833 | XP_011543166.1 | |
XM_011544865.2 | 5465 | Silent Mutation | CGG,CGT | R,R 1773 | XP_011543167.1 | |
XM_011544866.2 | 5465 | UTR 3 | XP_011543168.1 | |||
XM_011544867.2 | 5465 | Intron | XP_011543169.1 | |||
XM_011544868.2 | 5465 | Silent Mutation | CGG,CGT | R,R 1050 | XP_011543170.1 |
MIR192 - microRNA 192 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR194-2 - microRNA 194-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR194-2HG - MIR194-2 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6749 - microRNA 6749 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6750 - microRNA 6750 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |