Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTTCCGCTTGGCAGCTGCCTCCA[A/G]GGATGCCCAAAGTTCATCTGTCTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603189 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC105369332 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC105369332 - uncharacterized LOC105369332 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNU2-2P - RNA, U2 small nuclear 2, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STX5 - syntaxin 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001244666.1 | 1086 | Intron | NP_001231595.1 | |||
NM_003164.4 | 1086 | Intron | NP_003155.2 | |||
XM_011545223.2 | 1086 | Intron | XP_011543525.1 | |||
XM_011545224.2 | 1086 | Intron | XP_011543526.1 |
WDR74 - WD repeat domain 74 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001307977.1 | 1086 | Silent Mutation | CTG,TTG | L,L 333 | NP_001294906.1 | |
NM_018093.3 | 1086 | Silent Mutation | CTG,TTG | L,L 352 | NP_060563.2 | |
XM_005274055.2 | 1086 | Silent Mutation | CTG,TTG | L,L 352 | XP_005274112.1 |