Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGTTATCCCTCCCCCATGACCACA[C/G]AGCAGGCAAGGGGGCAGCAGGGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608965 | ||||||||||||||||||||
Literature Links: |
CABP4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CABP4 - calcium binding protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300895.1 | 87 | UTR 5 | NP_001287824.1 | |||
NM_001300896.1 | 87 | Intron | NP_001287825.1 | |||
NM_145200.3 | 87 | Missense Mutation | CAG,GAG | Q,E 4 | NP_660201.1 | |
XM_005274114.3 | 87 | Intron | XP_005274171.2 | |||
XM_011545181.2 | 87 | Intron | XP_011543483.1 | |||
XM_011545182.2 | 87 | Intron | XP_011543484.1 | |||
XM_011545183.2 | 87 | Intron | XP_011543485.1 | |||
XM_017018025.1 | 87 | Intron | XP_016873514.1 |
GPR152 - G protein-coupled receptor 152 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM134 - transmembrane protein 134 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |