Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTCTTAGTTTGTTCCTGTCTTTC[C/T]TCTTCACTCAAAGCGGGTTTGCCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616378 MIM: 616097 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LBHD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LBHD1 - LBH domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRN4CL - LRRN4 C-terminal like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBXN1 - UBX domain protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286077.1 | 370 | Silent Mutation | GAA,GAG | E,E 89 | NP_001273006.1 | |
NM_001286078.1 | 370 | Intron | NP_001273007.1 | |||
NM_015853.4 | 370 | Silent Mutation | GAA,GAG | E,E 89 | NP_056937.2 | |
XM_005274033.4 | 370 | Silent Mutation | GAA,GAG | E,E 89 | XP_005274090.1 | |
XM_011545090.2 | 370 | Silent Mutation | GAA,GAG | E,E 89 | XP_011543392.1 | |
XM_017017874.1 | 370 | Silent Mutation | GAA,GAG | E,E 89 | XP_016873363.1 |
UQCC3 - ubiquinol-cytochrome c reductase complex assembly factor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |