Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCGCAGTGAGATGAGGATCGGGT[C/T]GGCATCCCGCCCGCTCACCCACTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609849 MIM: 601577 MIM: 608939 | ||||||||||||||||||||
Literature Links: |
CORO1B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CORO1B - coronin 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018070.2 | 1267 | Missense Mutation | AAC,GAC | N,D 386 | NP_001018080.1 | |
NM_020441.2 | 1267 | Missense Mutation | AAC,GAC | N,D 386 | NP_065174.1 |
PTPRCAP - protein tyrosine phosphatase, receptor type C associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS6KB2 - ribosomal protein S6 kinase B2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |