Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATGCCATACTCGCTGAGGGCAGG[A/G]GTCAAGTCCTCCATGGTTAGAGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602366 MIM: 615818 MIM: 600475 MIM: 607998 | ||||||||||||||||||||
Literature Links: |
ILK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ILK - integrin linked kinase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014794.2 | 658 | Intron | NP_001014794.1 | |||
NM_001014795.2 | 658 | Intron | NP_001014795.1 | |||
NM_001278441.1 | 658 | Intron | NP_001265370.1 | |||
NM_001278442.1 | 658 | Intron | NP_001265371.1 | |||
NM_004517.3 | 658 | Intron | NP_004508.1 | |||
XM_005252904.4 | 658 | Intron | XP_005252961.1 | |||
XM_005252905.2 | 658 | Intron | XP_005252962.1 | |||
XM_011520065.1 | 658 | Intron | XP_011518367.1 | |||
XM_017017672.1 | 658 | Intron | XP_016873161.1 |
RRP8 - ribosomal RNA processing 8, methyltransferase, homolog (yeast) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF10 - TATA-box binding protein associated factor 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006284.3 | 658 | Silent Mutation | ACC,ACT | T,T 201 | NP_006275.1 |
TPP1 - tripeptidyl peptidase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |